stab2

Ensembl ID:
ENSDARG00000045748
ZFIN ID:
ZDB-GENE-041210-336
Description:
stabilin 2 [Source:RefSeq peptide;Acc:NP_001103503]
Human Orthologue:
STAB2
Human Description:
stabilin 2 [Source:HGNC Symbol;Acc:18629]
Mouse Orthologue:
Stab2
Mouse Description:
stabilin 2 Gene [Source:MGI Symbol;Acc:MGI:2178743]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11372 Essential Splice Site Available for shipment Available now
sa11212 Nonsense Available for shipment Available now
sa15213 Nonsense Available for shipment Available now
sa57 Nonsense Confirmed mutation in F2 line During 2018
sa33402 Nonsense Mutation detected in F1 DNA During 2018
hu7897 Essential Splice Site Available for shipment Available now
sa40232 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1575 Essential Splice Site Available for shipment Available now
sa11760 Nonsense Available for shipment Available now
sa40233 Nonsense Mutation detected in F1 DNA During 2018
sa40234 Nonsense Mutation detected in F1 DNA During 2018
sa33403 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa8752 Essential Splice Site Mutation detected in F1 DNA During 2018
sa26238 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31380 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Essential Splice Site 70 2508 2 67
ENSDART00000102534 Essential Splice Site 70 2509 2 68
ENSDART00000136000 Essential Splice Site 70 2444 2 64
Genomic Location (Zv9):
Chromosome 4 (position 9787234)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10723861
GRCz11 4 10722710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATGGATACGCTAAGATGCCACCAGGCACAAGCGATAGGGACTGCAGG[T/C]ACATATTYGTGTTTGTGTGTGTGNNNNTGGTTTTGTTTGCTTYACGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Nonsense 197 2508 7 67
ENSDART00000102534 Nonsense 197 2509 7 68
ENSDART00000136000 Nonsense 197 2444 7 64
Genomic Location (Zv9):
Chromosome 4 (position 9792492)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10729119
GRCz11 4 10727968
KASP Assay ID:
2259-4575.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTGAGTGTANTTTTTTCTTCTCAGAGCTCCCAGCATGTGCTGCTTTG[C/T]AGTGTGGGCCGGATTCTCRTTGTMTCGAGGAAATGTTGACAGGGCAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Nonsense 221 2508 7 67
ENSDART00000102534 Nonsense 221 2509 7 68
ENSDART00000136000 Nonsense 221 2444 7 64
Genomic Location (Zv9):
Chromosome 4 (position 9792566)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10729193
GRCz11 4 10728042
KASP Assay ID:
2259-4576.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MTCGAGGAAATGTTGACAGGGCAGCTTGTGTGCAAGTGYAAACCTGGTTA[T/A]CAAGGGGATGGAGTACAGTGTACATGTGAGTATATACTAAAATTACATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa57
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Nonsense 266 2508 8 67
ENSDART00000102534 Nonsense 266 2509 8 68
ENSDART00000136000 Nonsense 266 2444 8 64
Genomic Location (Zv9):
Chromosome 4 (position 9794561)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10731188
GRCz11 4 10730037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGAACAAGCATGTCTGCACATGTACAGAAGGCTATAGTGGCGACGGT[C/T]GAGTCTGCATGCCCATTGACCCATGCCAGACTAATCTAGGCAACTGCACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa33402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Nonsense 353 2508 10 67
ENSDART00000102534 Nonsense 353 2509 10 68
ENSDART00000136000 Nonsense 353 2444 10 64
Genomic Location (Zv9):
Chromosome 4 (position 9794990)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10731617
GRCz11 4 10730466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTCAGATGTAACTGCCGCGAAGGTTTCATTGGGAATGGAAAAATATG[C/A]TTTGGGGACATCATTCAACAGCTGAATGAAATGAATTCGAAGCCAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Essential Splice Site 684 2508 20 67
ENSDART00000102534 Essential Splice Site 684 2509 20 68
ENSDART00000136000 Essential Splice Site 684 2444 20 64
Genomic Location (Zv9):
Chromosome 4 (position 9801682)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10738309
GRCz11 4 10737158
KASP Assay ID:
554-2405.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTCAGTGACACTACTTTGATGCTTTTCCCCACCTTTTTATGACTCCA[G/A]AAGGCATACARWAGAGGCTGTGTTTTCAATAAGAAGCAACTTGGCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Essential Splice Site 926 2508 26 67
ENSDART00000102534 Essential Splice Site 926 2509 26 68
ENSDART00000136000 Essential Splice Site 926 2444 26 64
Genomic Location (Zv9):
Chromosome 4 (position 9804691)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10741318
GRCz11 4 10740167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACGTCTATCTAGATCTGCAGGGTTTTTGATGAATGTTATCCCACCTT[A/C]GATTGACTGTGCTTGCAAAAGTGGTTACCACGGCAACGGGAGGGAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Essential Splice Site 1005 2508 28 67
ENSDART00000102534 Essential Splice Site 1005 2509 28 68
ENSDART00000136000 Essential Splice Site 1005 2444 28 64
Genomic Location (Zv9):
Chromosome 4 (position 9805820)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10742447
GRCz11 4 10741296
KASP Assay ID:
554-1518.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGRTGTCGACAAACCCAGATCTTCTGGGTTTTAACCAGTGGATCTCC[G/T]TAAGTTACACTTTAGTGTGTTTTTTATGTTGACATTTGTTTAAAAGCAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Nonsense 1196 2508 34 67
ENSDART00000102534 Nonsense 1196 2509 34 68
ENSDART00000136000 Nonsense 1196 2444 34 64
Genomic Location (Zv9):
Chromosome 4 (position 9809205)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10745832
GRCz11 4 10744681
KASP Assay ID:
2259-4578.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTAGGATTTGAATGTGACCAWGTATCACATTATACTGACYGAGATTT[T/G]AAAAGAYGTAGATTTGGTGGAKGGACTGTACAAGGACACCATGCTGGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Nonsense 1311 2508 37 67
ENSDART00000102534 Nonsense 1311 2509 37 68
ENSDART00000136000   None 2444 None 64
Genomic Location (Zv9):
Chromosome 4 (position 9811646)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10748273
GRCz11 4 10747122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGATGCATGTACAGCCGGGTGTTGCATGGAGACACACTGCTGACCATT[G/T]GATGTAAATTTTCTTGTGAGAAAATGACCATTGTATGTACATTATACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Nonsense 1405 2508 39 67
ENSDART00000102534 Nonsense 1405 2509 39 68
ENSDART00000136000 Nonsense 1373 2444 38 64
Genomic Location (Zv9):
Chromosome 4 (position 9812103)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10748730
GRCz11 4 10747579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGTGTCCACGGACGCTGCAAAGATGGTATAGATGGAGATGGCAGCTG[T/A]GCATGTGATCTGGGCTGGAGAGGAGTAAACTGCGACATTGGTATGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Essential Splice Site 1634 2508 47 67
ENSDART00000102534 Essential Splice Site 1634 2509 47 68
ENSDART00000136000 Missense 1582 2444 45 64
Genomic Location (Zv9):
Chromosome 4 (position 9815223)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10751850
GRCz11 4 10750699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCCCTTTACAGTCTTTGCCTTCAGATCAGAAAATTATAAAAACCAG[G/A]TAAGAGTGAGAAAAGCAGCATACAGGGGAGAGTTAAACTTGCAATGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Essential Splice Site 1951 2508 None 67
ENSDART00000102534 Essential Splice Site 1951 2509 None 68
ENSDART00000136000 Essential Splice Site 1904 2444 None 64
Genomic Location (Zv9):
Chromosome 4 (position 9820568)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10757195
GRCz11 4 10756044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCTTAGACATAGACAANNNNNNGNNNNTTGCCAGCTGACAAAWATTAYCCTGTTCTCC[A/T]GCATGCCCTGGAGGTCCACAATCTCCTTGCAGCAACCATGGRAAATGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Essential Splice Site 2193 2508 60 67
ENSDART00000102534 Essential Splice Site 2194 2509 61 68
ENSDART00000136000 Essential Splice Site 2181 2444 59 64
Genomic Location (Zv9):
Chromosome 4 (position 9823180)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10759807
GRCz11 4 10758656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCGGGAAGCACCATCGCTACCTACATGCAGCTGTCCTATGCGCAGCAG[G/A]TGGTGCTCTTTAAAGAATACTTTGGTTTTTGGCTGCCACTAGGGCTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067253 Nonsense 2308 2508 63 67
ENSDART00000102534 Nonsense 2309 2509 64 68
ENSDART00000136000 Nonsense 2296 2444 62 64
Genomic Location (Zv9):
Chromosome 4 (position 9824565)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10761192
GRCz11 4 10760041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGCATCAGGAAAAGCATTCGTGAATCGCCTTCGGAACATCACTATC[C/T]AGTCCACTCTGTTTGTACCTGATAACGATGGTCTCTATAGCAACCAGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary restenosis: A genome-wide association study identifies a region at chromosome 12 as a potential susceptibility locus for restenosis after percutaneous coronary intervention. (View Study)
  • vWF and FVIII levels: Combined analysis of three genome-wide association studies on vWF and FVIII plasma levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link