zgc:91880

Ensembl ID:
ENSDARG00000045706
ZFIN ID:
ZDB-GENE-040704-25
Description:
Tetraspanin-9 [Source:UniProtKB/Swiss-Prot;Acc:Q6GMK6]
Human Orthologue:
TSPAN9
Human Description:
tetraspanin 9 [Source:HGNC Symbol;Acc:21640]
Mouse Orthologue:
Tspan9
Mouse Description:
tetraspanin 9 Gene [Source:MGI Symbol;Acc:MGI:1924558]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20211 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067190 Nonsense 27 239 3 8
Genomic Location (Zv9):
Chromosome 4 (position 8765677)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9702525
GRCz11 4 9703441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGTAATGTCTCTCTGTGTGTGTTTGTCCTCAGCTGTCGGGATGTGGGT[T/A]GTTGGGTGTGGGCATCTGGCTGTCCGTTTCGCAGGGCAGCTTTGCCACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link