si:dkey-240a12.3

Ensembl ID:
ENSDARG00000045687
ZFIN ID:
ZDB-GENE-041210-237
Description:
hypothetical protein LOC798289 [Source:RefSeq peptide;Acc:NP_001076392]
Human Orthologue:
PDZRN4
Human Description:
PDZ domain containing ring finger 4 [Source:HGNC Symbol;Acc:30552]
Mouse Orthologue:
Pdzrn4
Mouse Description:
PDZ domain containing RING finger 4 Gene [Source:MGI Symbol;Acc:MGI:3056996]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31387 Essential Splice Site Available for shipment Available now
sa2153 Nonsense F2 line generated During 2018
sa10439 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067168 Essential Splice Site 267 788 8 8
Genomic Location (Zv9):
Chromosome 4 (position 12924399)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13861026
GRCz11 4 13859875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCATGTTCTGTCAGGTATTAAGCAATTGTGTCTGTTTGTGTTTTGC[A/T]GTCTACAAGGCAGGAGGATGCAAGTACAGATACAGCAACATGCTCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2153
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067168 Nonsense 446 788 8 8
Genomic Location (Zv9):
Chromosome 4 (position 12924938)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13861565
GRCz11 4 13860414
KASP Assay ID:
554-2665.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGCGACGTGGCAAGCTTGCAGATATTAATGAGCATCCTGAAAGACTA[C/T]AAAGTGAGAAGCTCAGAGATAAAGACAGCTCTAGTGCCTACAATACAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067168 Nonsense 451 788 8 8
Genomic Location (Zv9):
Chromosome 4 (position 12924953)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13861580
GRCz11 4 13860429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTGCAGATATTAATGAGCATCCTGAAAGACTAYAAAGTGAGAAGCTC[A/T]GAGATAAAGACAGCTCTAGTGCCTACAATACAGCTGAAAGTTCCCGCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link