si:ch211-266a5.1

Ensembl ID:
ENSDARG00000045683
ZFIN ID:
ZDB-GENE-041210-118
Description:
hypothetical protein LOC556936 [Source:RefSeq peptide;Acc:NP_001038282]
Human Orthologue:
CCDC87
Human Description:
coiled-coil domain containing 87 [Source:HGNC Symbol;Acc:25579]
Mouse Orthologue:
Ccdc87
Mouse Description:
coiled-coil domain containing 87 Gene [Source:MGI Symbol;Acc:MGI:3026882]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45171 Nonsense Mutation detected in F1 DNA During 2018
sa18779 Nonsense Mutation detected in F1 DNA During 2018
sa9070 Nonsense Mutation detected in F1 DNA During 2018
sa33424 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067165 Nonsense 58 825 2 19
ENSDART00000141395 Nonsense 43 734 2 18
ENSDART00000144310 Nonsense 43 246 2 5
Genomic Location (Zv9):
Chromosome 4 (position 12681046)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13617673
GRCz11 4 13616522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAATCATGCAGATATCACAGCGTTACTCCATCTGTGATGAAGACCGA[C/T]AGTCTCTGGTCAGACAGATTAAAAATATATTGCAGACATTGTCTAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067165 Nonsense 539 825 13 19
ENSDART00000141395 Nonsense 524 734 13 18
ENSDART00000144310   None 246 None 5
ENSDART00000067165 Nonsense 539 825 13 19
ENSDART00000141395 Nonsense 524 734 13 18
ENSDART00000144310   None 246 None 5
Genomic Location (Zv9):
Chromosome 4 (position 12685582)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13622209
GRCz11 4 13621058
KASP Assay ID:
2259-4681.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTGGCTTCGAAGGACTCTGATTATCTGCCAGTTCTGTTTCACTTGTA[T/G]GACAGTGACGATGATGGTGAAGAGGCAGAGAGACACAAGTTGGATCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067165 Nonsense 539 825 13 19
ENSDART00000141395 Nonsense 524 734 13 18
ENSDART00000144310   None 246 None 5
ENSDART00000067165 Nonsense 539 825 13 19
ENSDART00000141395 Nonsense 524 734 13 18
ENSDART00000144310   None 246 None 5
Genomic Location (Zv9):
Chromosome 4 (position 12685582)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13622209
GRCz11 4 13621058
KASP Assay ID:
2259-4681.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTGGCTTCGAAGGACTCTGATTATCTGCCAGTKCTGTTTCACTTGTA[T/G]GACAGTGACGATGATGRTGAAGAGGCAGAGAGACACAAGTTGGATCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067165 Nonsense 671 825 17 19
ENSDART00000141395 Nonsense 656 734 17 18
ENSDART00000144310   None 246 None 5
Genomic Location (Zv9):
Chromosome 4 (position 12687843)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13624470
GRCz11 4 13623319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGCATTTGTCCTATCAGGCTATTGCTGCATGGGAGCAGGCCACCTGTT[T/A]GATCCAGAAGAGGGAGCTCTTGCTTTCCAGGTTGGAGGACTTTGAGAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link