si:dkey-39a18.1

Ensembl ID:
ENSDARG00000045669
ZFIN ID:
ZDB-GENE-041210-127
Description:
hypothetical protein LOC557637 [Source:RefSeq peptide;Acc:NP_001020665]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9685 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067151 Essential Splice Site 50 349 3 6

The following transcripts of ENSDARG00000045669 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 12494904)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13431531
GRCz11 4 13430380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTGTACCATCATATTTCTCAGAACCGGTCTCGTTCCTGCAGCACAGG[G/A]TAACACAATTGGATCWTTAAGACYGCTGACCACCATATATTTGACAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link