ANKRD50 (1 of 2)

Ensembl ID:
ENSDARG00000045666
Description:
ankyrin repeat domain 50 [Source:HGNC Symbol;Acc:29223]
Human Orthologue:
ANKRD50
Human Description:
ankyrin repeat domain 50 [Source:HGNC Symbol;Acc:29223]
Mouse Orthologues:
Ankrd50, E230028L10Rik
Mouse Descriptions:
ankyrin repeat domain 50 Gene [Source:MGI Symbol;Acc:MGI:2139777]
RIKEN cDNA E230028L10 gene Gene [Source:MGI Symbol;Acc:MGI:2685285]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31967 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067147 Nonsense 764 1176 1 1
Genomic Location (Zv9):
Chromosome 14 (position 476959)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 445452
GRCz11 14 468345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCAGGTTGTTGATCAACTACCATGCAGATGTGAACTCATGTGATAAC[G/T]AGAAACGATCGGCTCTCCAGTCCGCAGCTTGGCAGGGTCACATAAAGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link