elavl4

Ensembl ID:
ENSDARG00000045639
ZFIN ID:
ZDB-GENE-990415-246
Description:
ELAV-like protein 4 [Source:RefSeq peptide;Acc:NP_571528]
Human Orthologue:
ELAVL4
Human Description:
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) [Source:HGNC Symbol;Acc:3
Mouse Orthologue:
Elavl4
Mouse Description:
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene [Source:MGI Symbol;A

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45316 Nonsense Mutation detected in F1 DNA During 2018
sa34358 Nonsense Mutation detected in F1 DNA During 2018
sa16615 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028601   None 367 None 8
ENSDART00000110171   None 403 None 8
ENSDART00000134787 Nonsense 13 408 1 8
ENSDART00000141173 Nonsense 13 130 1 4

The following transcripts of ENSDARG00000045639 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 16524074)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15968962
GRCz11 8 16004674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCACCAACAAGATGTTTGAAATCAGCCGAACACTGAACGCTGCTTTGT[T/A]GAGCAATGAGGTAAAGGAATCGGATTTTCTTCTTCTTCTGTCACCTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028601 Nonsense 119 367 5 8
ENSDART00000110171 Nonsense 155 403 5 8
ENSDART00000134787 Nonsense 163 408 5 8
ENSDART00000141173   None 130 None 4

The following transcripts of ENSDARG00000045639 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 16612693)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16057581
GRCz11 8 16093293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACATGATCACAATTAATACTCGTGTGTTTTGTCTACAGGTGTCATA[T/A]GCACGGCCCAGCTCAGCTTCTATTCGTGATGCTAATCTATATGTGAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028601 Nonsense 302 367 8 8
ENSDART00000110171 Nonsense 338 403 8 8
ENSDART00000134787 Nonsense 343 408 8 8
ENSDART00000141173   None 130 None 4

The following transcripts of ENSDARG00000045639 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 16631493)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16076381
GRCz11 8 16112093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCTTCGTCTACAACCTCTCCCCAGACTCGGACGAGAGTGTCCTGTGG[C/T]AGYTCWTCGGACCRTTTGGTGCCGTCAACAATGTCAAGGTGATCCGCGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link