slc13a1

Ensembl ID:
ENSDARG00000045638
ZFIN ID:
ZDB-GENE-031222-3
Description:
solute carrier family 13 member 1 [Source:RefSeq peptide;Acc:NP_954975]
Human Orthologue:
SLC13A1
Human Description:
solute carrier family 13 (sodium/sulfate symporters), member 1 [Source:HGNC Symbol;Acc:10916]
Mouse Orthologue:
Slc13a1
Mouse Description:
solute carrier family 13 (sodium/sulfate symporters), member 1 Gene [Source:MGI Symbol;Acc:MGI:18599

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45856 Nonsense Mutation detected in F1 DNA During 2018
sa32538 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047007 Nonsense 498 583 14 15
Genomic Location (Zv9):
Chromosome 25 (position 28797877)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27487971
GRCz11 25 27931173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGAGCTACTCTCATCAAAAAAATTATCTTTGTCAGGCCGAGGCAATC[G/T]GAGTCAACCCTCTGTACATGCTGATTCCCACGGCTTTGGCTGTGTCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047007 Nonsense 582 583 15 15
Genomic Location (Zv9):
Chromosome 25 (position 28798768)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27488862
GRCz11 25 27932064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTAAGTTGGATACCTACCCAGACTGGGCACCGGTGGTAAACAGCACT[G/T]GAGTATGACCATAATTCTGAGCATTTTAGAAATGTGAACATTTAGTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link