zgc:77221

Ensembl ID:
ENSDARG00000045625
ZFIN ID:
ZDB-GENE-040426-1805
Description:
hypothetical protein LOC402955 [Source:RefSeq peptide;Acc:NP_991220]
Human Orthologue:
THUMPD1
Human Description:
THUMP domain containing 1 [Source:HGNC Symbol;Acc:23807]
Mouse Orthologue:
Thumpd1
Mouse Description:
THUMP domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2444479]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12881 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067096 Nonsense 245 343 5 5
Genomic Location (Zv9):
Chromosome 1 (position 60039730)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58483323
GRCz11 1 58985374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGTCWGCTGCGTCAGCGTCGTCACCGACTACATGCTCTTCCGCAAGTA[C/A]AACCTGCAGGAGGTGGCCAAAGAGCCGGCCAATCAGAACACAGGCTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link