zgc:77126

Ensembl ID:
ENSDARG00000045620
ZFIN ID:
ZDB-GENE-030131-1500
Description:
sialic acid synthase [Source:RefSeq peptide;Acc:NP_996660]
Human Orthologue:
NANS
Human Description:
N-acetylneuraminic acid synthase [Source:HGNC Symbol;Acc:19237]
Mouse Orthologue:
Nans
Mouse Description:
N-acetylneuraminic acid synthase (sialic acid synthase) Gene [Source:MGI Symbol;Acc:MGI:2149820]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39567 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067086 Nonsense 99 359 2 6
Genomic Location (Zv9):
Chromosome 1 (position 11634946)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11651954
GRCz11 1 12338754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGCATAAGCGACACCTGGAGTTCAGTCATGAGCAGTACAGGGAGCTG[C/T]AGCAGTACGCTAAACAAGTGGGCATCTTCTTCACTGCGTCTGGAATGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link