si:dkey-14k9.3

Ensembl ID:
ENSDARG00000045595
ZFIN ID:
ZDB-GENE-030131-2893
Description:
hypothetical protein LOC324173 [Source:RefSeq peptide;Acc:NP_001034152]
Human Orthologue:
ZNF697
Human Description:
zinc finger protein 697 [Source:HGNC Symbol;Acc:32034]
Mouse Orthologue:
Zfp697
Mouse Description:
zinc finger protein 697 Gene [Source:MGI Symbol;Acc:MGI:2139736]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45172 Nonsense Mutation detected in F1 DNA During 2018
sa15386 Nonsense Available for shipment Available now
sa40257 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067036 Nonsense 192 471 3 3
ENSDART00000137829 Nonsense 152 431 2 2
Genomic Location (Zv9):
Chromosome 4 (position 13961740)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14897593
GRCz11 4 14896348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCGCCAGGAGAAACCATCACAGAACCCATCCCGAAGAAACCTTGAAT[C/T]AATGCACCGCCTGCGGGAAGAAGCTCAGCAGTCAAGCGGCTCTTAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067036 Nonsense 217 471 3 3
ENSDART00000137829 Nonsense 177 431 2 2
Genomic Location (Zv9):
Chromosome 4 (position 13961665)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14897518
GRCz11 4 14896273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCAGTCAAGCGGCTCTTAAAAGACACAAGCAAATCCACGAAGAGAAG[C/T]AATCCTATAATTGCTCCAAATGCAAGTCCACCTTCATCTGCYCGACCTCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067036 Nonsense 413 471 3 3
ENSDART00000137829 Nonsense 373 431 2 2
Genomic Location (Zv9):
Chromosome 4 (position 13961077)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14896930
GRCz11 4 14895685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGTCCACATGAGGCAGCACACCGGCGTACGGCCCTATTCCTGTTCC[C/T]AATGCGACAAGAGTTTCTACAGTTCGTCCCATCTCAAGAGGCACCTGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link