socs2

Ensembl ID:
ENSDARG00000045557
ZFIN ID:
ZDB-GENE-041210-171
Description:
suppressor of cytokine signaling 2 [Source:RefSeq peptide;Acc:NP_001108022]
Human Orthologue:
SOCS2
Human Description:
suppressor of cytokine signaling 2 [Source:HGNC Symbol;Acc:19382]
Mouse Orthologues:
Gm9847, Socs2
Mouse Descriptions:
predicted pseudogene 9847 Pseudogene [Source:MGI Symbol;Acc:MGI:3642840]
suppressor of cytokine signaling 2 Gene [Source:MGI Symbol;Acc:MGI:1201787]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13561 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035358 Nonsense 175 197 2 2
ENSDART00000141671 Nonsense 133 155 1 1
Genomic Location (Zv9):
Chromosome 4 (position 17501108)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18443948
GRCz11 4 18432924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACGCCGTCCCTGCAGCACCTGTGCCGTATTGCCATCAATAAAACCACA[C/T]GACGGGTACAAGAACTTCCTTTGCCCAACCGGCTGAAGGATTACCTGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link