slco1f4

Ensembl ID:
ENSDARG00000045469
ZFIN ID:
ZDB-GENE-070112-2172
Description:
solute carrier organic anion transporter family, member 1F4 [Source:RefSeq peptide;Acc:NP_001074135
Human Orthologue:
SLCO1C1
Human Description:
solute carrier organic anion transporter family, member 1C1 [Source:HGNC Symbol;Acc:13819]
Mouse Orthologue:
Slco1c1
Mouse Description:
solute carrier organic anion transporter family, member 1c1 Gene [Source:MGI Symbol;Acc:MGI:1889679]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40338 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10903 Essential Splice Site Available for shipment Available now
sa18792 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6052 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20314 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084603 Essential Splice Site 132 571 6 15
Genomic Location (Zv9):
Chromosome 4 (position 60484751)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70649738
GRCz11 4 72165831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATTCATAGATGATTATGCACGGCCAGAAAACTCTGCTTTTTACATTG[G/A]TGAGAGGATTGTTATTGTTATTAATAATATTAGTACTTTCATTGTGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084603 Essential Splice Site 234 571 9 15
ENSDART00000084603 Essential Splice Site 234 571 9 15
Genomic Location (Zv9):
Chromosome 4 (position 60487371)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70647118
GRCz11 4 72163211
KASP Assay ID:
2259-5221.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATWNAAAAAAAATCYRATTGTTTAAAAAGTGWGCTATDTTCTTGTTTTCT[A/T]GATTTTGCACCAACTTTTAAGCGYCTGCTSACCAATAAGRTCTACATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084603 Essential Splice Site 234 571 9 15
ENSDART00000084603 Essential Splice Site 234 571 9 15
Genomic Location (Zv9):
Chromosome 4 (position 60487371)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70647118
GRCz11 4 72163211
KASP Assay ID:
2259-5221.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAAAAAAAATCTGATTGTTTAAAAAGTGTGCTATATTCTTGTTTTCT[A/T]GATTTTGCACCAACTTTTAAGCGTCTGCTCACCAATAAGATCTACATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084603 Essential Splice Site 471 571 13 15
Genomic Location (Zv9):
Chromosome 4 (position 60489614)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70644875
GRCz11 4 72160968
KASP Assay ID:
554-3920.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTGCMAAAAGTTTACATCAAAATGCGTACTGAGAACATGTTCTTGC[A/T]GGATTGTGRATCCTGAGCTGAAGTCTCTCTCTGTGGGAATGTTACTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084603 Nonsense 564 571 15 15
Genomic Location (Zv9):
Chromosome 4 (position 60490072)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70644417
GRCz11 4 72160510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCCTGCTTTGGATAGCCACCATAGAGATAAAGAGAAAAAATACTGAA[C/T]AACAAACAAATGTCTCAAGACACTGAACTCCAAATGCCTTTGTGCGATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link