
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:158293
- Ensembl ID:
- ENSDARG00000045465
- ZFIN ID:
- ZDB-GENE-070209-191
- Description:
- lanC-like protein 2 [Source:RefSeq peptide;Acc:NP_001076472]
- Human Orthologue:
- LANCL2
- Human Description:
- LanC lantibiotic synthetase component C-like 2 (bacterial) [Source:HGNC Symbol;Acc:6509]
- Mouse Orthologue:
- Lancl2
- Mouse Description:
- LanC (bacterial lantibiotic synthetase component C)-like 2 Gene [Source:MGI Symbol;Acc:MGI:1919085]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24423 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24423
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100417 | Nonsense | 243 | 435 | 6 | 11 |
ENSDART00000134772 | None | 171 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 24 (position 509089)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 449061 GRCz11 24 178720 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGAACTTGTCTAAAGAGGAGAAGAAGAGCGAGCGATGCCCGCTGCTGTA[C/A]GAGTGGCACAAGAAGCAGTATGTCGGAGCCGCTCACGGCCTGGCCGGGAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: