zgc:158293

Ensembl ID:
ENSDARG00000045465
ZFIN ID:
ZDB-GENE-070209-191
Description:
lanC-like protein 2 [Source:RefSeq peptide;Acc:NP_001076472]
Human Orthologue:
LANCL2
Human Description:
LanC lantibiotic synthetase component C-like 2 (bacterial) [Source:HGNC Symbol;Acc:6509]
Mouse Orthologue:
Lancl2
Mouse Description:
LanC (bacterial lantibiotic synthetase component C)-like 2 Gene [Source:MGI Symbol;Acc:MGI:1919085]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24423 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100417 Nonsense 243 435 6 11
ENSDART00000134772   None 171 None 5
Genomic Location (Zv9):
Chromosome 24 (position 509089)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 449061
GRCz11 24 178720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAACTTGTCTAAAGAGGAGAAGAAGAGCGAGCGATGCCCGCTGCTGTA[C/A]GAGTGGCACAAGAAGCAGTATGTCGGAGCCGCTCACGGCCTGGCCGGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link