zgc:152982

Ensembl ID:
ENSDARG00000045453
ZFIN ID:
ZDB-GENE-060929-1250
Description:
hypothetical protein LOC767742 [Source:RefSeq peptide;Acc:NP_001070179]
Human Orthologue:
F13A1
Human Description:
coagulation factor XIII, A1 polypeptide [Source:HGNC Symbol;Acc:3531]
Mouse Orthologue:
F13a1
Mouse Description:
coagulation factor XIII, A1 subunit Gene [Source:MGI Symbol;Acc:MGI:1921395]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45816 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24434 Essential Splice Site Available for shipment Available now
sa44072 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30027 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066853   None 726 None 14
ENSDART00000146887 Essential Splice Site None 726 2 15
Genomic Location (Zv9):
Chromosome 24 (position 2532705)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2502703
GRCz11 24 2498747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTGTGTAAAGTGTTTTTAAGTCTTACATTAATATGATCTGTCCTCC[A/T]GGTTCTTGTGAAGATCTTGTGAACATCATGGCTCTTCCGTCCCACCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066853 Essential Splice Site 230 726 4 14
ENSDART00000146887 Essential Splice Site 230 726 5 15
Genomic Location (Zv9):
Chromosome 24 (position 2536931)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2506929
GRCz11 24 2502973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGGAGAAATAAACGACATTTCCTTCCGTTCATGGAACTACGGCCAGG[T/C]TAGTGCTTTCTCAAACAACTGCTCTTCTATTCAATCTGATACCTTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066853 Essential Splice Site 487 726 10 14
ENSDART00000146887 Essential Splice Site 487 726 11 15
Genomic Location (Zv9):
Chromosome 24 (position 2543890)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2513888
GRCz11 24 2509932
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACACTAACGGCTACATTGACATCACCTTGAACTATAAATATCCAAAAG[G/A]TAAGATTCATGTGTGCCAAGAAAACATTGGAGGCCTCATTTATAAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066853 Nonsense 707 726 14 14
ENSDART00000146887 Nonsense 707 726 15 15
Genomic Location (Zv9):
Chromosome 24 (position 2548237)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2518235
GRCz11 24 2514279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGACACCATCACCCCTTATTCTCCAGGGAGGAAGGTGTTGATAGGCTG[T/A]CTGGACTGCATCCCACTGAGTCAGATCACCAATCAGCTGGAAATCAACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link