tmem22

Ensembl ID:
ENSDARG00000045447
ZFIN ID:
ZDB-GENE-050320-142
Description:
transmembrane protein 22 [Source:RefSeq peptide;Acc:NP_001013581]
Human Orthologue:
TMEM22
Human Description:
transmembrane protein 22 [Source:HGNC Symbol;Acc:28480]
Mouse Orthologue:
Tmem22
Mouse Description:
transmembrane protein 22 Gene [Source:MGI Symbol;Acc:MGI:2685365]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37809 Nonsense Available for shipment Available now
sa37808 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066839 Nonsense 220 413 2 2
Genomic Location (Zv9):
Chromosome 24 (position 3492408)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 3382901
GRCz11 24 3414688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTTAGCGCAGTTCTGGCCTTTTTGCTTCTCGACGAACGCCTTGGTTA[T/A]ACTGATGTAGTGACTGTCGTCGGCAGCCTTTTCGGACTTTGTCTTGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066839 Nonsense 337 413 2 2
Genomic Location (Zv9):
Chromosome 24 (position 3492057)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 3382550
GRCz11 24 3414337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACAGGAATCTGCATATGCTCCACCGTTGCGTTTCTTGGCGTCTACTA[C/A]GCCCTCAACAAGTTCCACCCGGCCTTGGTCAGCACCGTACAGCATCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link