si:dkey-96n2.3

Ensembl ID:
ENSDARG00000045427
ZFIN ID:
ZDB-GENE-091204-118
Human Orthologue:
GPR17
Human Description:
G protein-coupled receptor 17 [Source:HGNC Symbol;Acc:4471]
Mouse Orthologue:
Gpr17
Mouse Description:
G protein-coupled receptor 17 Gene [Source:MGI Symbol;Acc:MGI:3584514]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44092 Nonsense Mutation detected in F1 DNA During 2018
sa14247 Nonsense Available for shipment Available now
sa10107 Nonsense Available for shipment Available now
sa15897 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066805 Nonsense 155 293 1 1
Genomic Location (Zv9):
Chromosome 24 (position 9405634)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9464518
GRCz11 24 9604904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCTCCAGAAGCCAAGTGACTAGAGAATGGCAGAACGTGACAGTATGT[G/T]AAAAGCTATACATAGAGACGTCTTCCAATCCCACTGGAGCACTGGTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066805 Nonsense 187 293 1 1
Genomic Location (Zv9):
Chromosome 24 (position 9405732)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9464616
GRCz11 24 9605002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAYCGCTGTTTCATTCCTCGTTCCTTTGGTTATTTTGAGTKTTTCTTA[T/A]ATTCTGATATTTTGGAGGGTCAAACAAATGACTTTTCAAGARYRGACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066805 Nonsense 202 293 1 1
Genomic Location (Zv9):
Chromosome 24 (position 9405775)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9464659
GRCz11 24 9605045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTTATATTCTGATATTTTGGAGGGTCAAACAAATGACTTTTCAAGAR[C/T]RGACGCCTGCWCAGCGCAAGGCCATGAGAATGATTGTACTTACGGTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066805 Nonsense 252 293 1 1
Genomic Location (Zv9):
Chromosome 24 (position 9405927)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9464811
GRCz11 24 9605197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAGCATGAKGACATGTCAAGGTCAGAAKCAGAAAGACGAATGCTGTA[T/A]CTGGGAAATCGTAYTACCTCAGCTTTGACGTGCGTCAGTGGTGTGTTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link