zgc:173856

Ensembl ID:
ENSDARG00000045424
ZFIN ID:
ZDB-GENE-030131-5358
Description:
Zgc:171750 protein [Source:UniProtKB/TrEMBL;Acc:A8KBP7]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7525 Missense Mutation detected in F1 DNA During 2018
sa37831 Nonsense Mutation detected in F1 DNA During 2018
sa24451 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066798   None 373 None 4
ENSDART00000113880 Missense 4 750 3 3
ENSDART00000137250 Missense 59 805 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9821690)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9880574
GRCz11 24 10020960
KASP Assay ID:
554-4287.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTGGAGGCCATGTTGGATCTARTAATCCTAGTCTGTCCATGCAGAAG[G/A]TGAAACAAAGTCTCTATGACTTTTATGGTGGAACTGCTGTAGTTGGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066798   None 373 None 4
ENSDART00000113880 Nonsense 91 750 3 3
ENSDART00000137250 Nonsense 146 805 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9821428)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9880312
GRCz11 24 10020698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGGTTCTGTGGTAAATGCAGCGAGTATGGGCATGTCTGAATATGATT[C/A]AAGTCAGTCAACTTCTGTCCAAGGCTCTGAAGTCATCAGTTCTTCTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066798   None 373 None 4
ENSDART00000113880 Nonsense 747 750 3 3
ENSDART00000137250 Nonsense 802 805 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9819461)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9878345
GRCz11 24 10018731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGGAAGCAATACGCATTCATCACGGAAGTTGCTTAAGCTGTTGCAA[C/T]AAGTCAAGTCCTAGGTGTTTGTTTGCGGTTTCCTCCTTTATGCTTGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link