zgc:122991

Ensembl ID:
ENSDARG00000045423
ZFIN ID:
ZDB-GENE-051113-316

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24452 Nonsense Available for shipment Available now
sa7526 Missense Mutation detected in F1 DNA During 2018
sa44096 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066797 Nonsense 133 748 1 4
ENSDART00000111521 Nonsense 177 809 3 4
Genomic Location (Zv9):
Chromosome 24 (position 9829466)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9888350
GRCz11 24 10028736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTGTTTCTAAGCCTAAGCCAGTACAGGTAGTTTCCTCAATTCCACTT[C/T]GAATTAACAGTATGTCTGTGGCAAAGCCCAGTAGCCAACAAATTGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7526
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066797 Missense 314 748 1 4
ENSDART00000111521 Missense 358 809 3 4
Genomic Location (Zv9):
Chromosome 24 (position 9830010)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9888894
GRCz11 24 10029280
KASP Assay ID:
554-4383.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCAGCAGCTAATACAGGCAGGCCAATCTGTCTCAACGCCAAATGTAC[A/T]ACCAGTAGATGCAAGTTATGTTTTTGTGGCTCAACCCARTGGACTGCARC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066797 Nonsense 373 748 1 4
ENSDART00000111521 Nonsense 417 809 3 4
Genomic Location (Zv9):
Chromosome 24 (position 9830186)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9889070
GRCz11 24 10029456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTTCTGTAGGTCAGTCCAGTAGCCAGATGCCAGCACAAACCAGCTAC[C/T]AGTCTGTGTCTCAACCATCTCTACAACTGCCAGTACAAGCCAGCTACCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link