
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gnal
- Ensembl ID:
- ENSDARG00000045415
- ZFIN ID:
- ZDB-GENE-041114-26
- Description:
- guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory typ
- Human Orthologue:
- GNAL
- Human Description:
- guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory typ
- Mouse Orthologue:
- Gnal
- Mouse Description:
- guanine nucleotide binding protein, alpha stimulating, olfactory type Gene [Source:MGI Symbol;Acc:MG
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1505 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1505
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066782 | Nonsense | 300 | 379 | 10 | 12 |
ENSDART00000140924 | Nonsense | 300 | 331 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 24 (position 8766639)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 8826018 GRCz11 24 8966404 - KASP Assay ID:
- 554-1430.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAAAGATCCTGGCAGGAAAATCTAAACTTGAAGATTATTTTCCAGAGTA[C/A]GCTCGCTACACACYTCCCCCTGAAGGTAATGTATYGTGTATGATCATAAT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- QT interval (interaction): Drug-gene interactions and the search for missing heritability: a cross-sectional pharmacogenomics study of the QT interval. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: