pi15a

Ensembl ID:
ENSDARG00000045378
ZFIN ID:
ZDB-GENE-040724-135
Description:
Peptidase inhibitor 15-A [Source:UniProtKB/Swiss-Prot;Acc:Q7T141]
Human Orthologue:
PI15
Human Description:
peptidase inhibitor 15 [Source:HGNC Symbol;Acc:8946]
Mouse Orthologue:
Pi15
Mouse Description:
peptidase inhibitor 15 Gene [Source:MGI Symbol;Acc:MGI:1934659]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45822 Nonsense Mutation detected in F1 DNA During 2018
sa24466 Nonsense Available for shipment Available now
sa45823 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012597 Nonsense 88 260 1 5
ENSDART00000141620 Nonsense 88 260 2 6
Genomic Location (Zv9):
Chromosome 24 (position 14708122)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14659570
GRCz11 24 14803989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCTTGATTACCATAATAAAGTTAGAGGGAAAGTTTTCCCCCCAGCCT[C/A]AAACATGGAATATATGGTAAGTCACTTCAGTTACTTTTTTTCCTTAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012597 Nonsense 219 260 5 5
ENSDART00000141620 Nonsense 219 260 6 6
Genomic Location (Zv9):
Chromosome 24 (position 14714429)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14665877
GRCz11 24 14810296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTGTCAATAACTGTGCTGTTGCTGTTTTTGTTTACAGGGGGAACTG[G/A]ATTGGTGAAGCCCCATATAAAGTAGGTGTTCCTTGTTCCATGTGTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012597 Nonsense 238 260 5 5
ENSDART00000141620 Nonsense 238 260 6 6
Genomic Location (Zv9):
Chromosome 24 (position 14714486)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14665934
GRCz11 24 14810353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGCCCCATATAAAGTAGGTGTTCCTTGTTCCATGTGTCCTCCAAGCTA[T/G]GGAGGATCGTGCAGTAACAACATGTGCTTTCCTGCTGTGAACTCAAATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link