
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
trappc3
- Ensembl ID:
- ENSDARG00000045364
- ZFIN ID:
- ZDB-GENE-040801-120
- Description:
- trafficking protein particle complex subunit 3 [Source:RefSeq peptide;Acc:NP_001003601]
- Human Orthologue:
- TRAPPC3
- Human Description:
- trafficking protein particle complex 3 [Source:HGNC Symbol;Acc:19942]
- Mouse Orthologue:
- Trappc3
- Mouse Description:
- trafficking protein particle complex 3 Gene [Source:MGI Symbol;Acc:MGI:1351486]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43319 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa14418 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43319
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066712 | Essential Splice Site | 14 | 180 | 1 | 5 |
- Genomic Location (Zv9):
- Chromosome 19 (position 37281596)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 36146116 GRCz11 19 35733236 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACAACATGTCTAGGCAGTCAAACAGAGCCACGGACAGCAAGAAGATGG[T/G]GAGTGTGTATCGTGTTGTTTCAGTTACTACATAAACCCAAGGCTGCTAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14418
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066712 | Essential Splice Site | 47 | 180 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 19 (position 37277847)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 36142367 GRCz11 19 35729487 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTAAGGACTATGAAAATGATGAAGAGGTCAACAAACAACTGGATAAAATG[T/G]RAGTCTGCCTTTCCCTTGCTTTCATTCTGATTTAGYCCTCTCATCAYYAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: