zgc:56530

Ensembl ID:
ENSDARG00000045352
ZFIN ID:
ZDB-GENE-040426-1065
Description:
cystatin B [Source:RefSeq peptide;Acc:NP_001096599]
Human Orthologues:
CSTA, CSTB
Human Descriptions:
cystatin A (stefin A) [Source:HGNC Symbol;Acc:2481]
cystatin B (stefin B) [Source:HGNC Symbol;Acc:2482]
Mouse Orthologues:
2010005H15Rik, BC100530, Csta, Cstb, Gm10092, Gm1975, Gm4758, Gm5416, Gm5483, Gm5689, Stfa1, Stfa2, Stfa2l1, Stfa3
Mouse Descriptions:
cDNA sequence BC100530 Gene [Source:MGI Symbol;Acc:MGI:3696883]
cystatin A Gene [Source:MGI Symbol;Acc:MGI:3524930]
cystatin B Gene [Source:MGI Symbol;Acc:MGI:109514]
predicted gene 10092 Gene [Source:MGI Symbol;Acc:MGI:3642362]
predicted gene 1975 Gene [Source:MGI Symbol;Acc:MGI:3780144]
predicted gene 4758 Gene [Source:MGI Symbol;Acc:MGI:3648404]
predicted gene 5416 Gene [Source:MGI Symbol;Acc:MGI:3644688]
predicted gene 5483 Gene [Source:MGI Symbol;Acc:MGI:3645124]
predicted gene 5689 Pseudogene [Source:MGI Symbol;Acc:MGI:3647214]
RIKEN cDNA 2010005H15 gene Gene [Source:MGI Symbol;Acc:MGI:1924020]
stefin A1 Gene [Source:MGI Symbol;Acc:MGI:106198]
stefin A2 Gene [Source:MGI Symbol;Acc:MGI:106197]
stefin A2 like 1 Gene [Source:MGI Symbol;Acc:MGI:3524944]
stefin A3 Gene [Source:MGI Symbol;Acc:MGI:106196]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24486 Nonsense Available for shipment Available now
sa7517 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037224 Nonsense 3 100 1 3
Genomic Location (Zv9):
Chromosome 24 (position 21529139)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20776268
GRCz11 24 20920687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTGCGAACGCGTGTTAAAACGCCTACAAGCTTTATTCAAAATGCCTT[T/A]AGTTTGTGGCGGAACTTCCGAAGCTAAAGATGCAAATGAAGAAGTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037224 Missense 42 100 2 3
Genomic Location (Zv9):
Chromosome 24 (position 21529341)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20776470
GRCz11 24 20920889
KASP Assay ID:
554-4337.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGGCTGATGCYGAGGAAAAAGCSGGGCGCAAGTTTGACGTTTTYACT[G/A]CTAAATCTTTTAAAACGCAGSTTGTYGCGGGGACAAATTACTWCGTTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Calcium levels: Common variants in the calcium-sensing receptor gene are associated with total serum calcium levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link