
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
map7d2b
- Ensembl ID:
- ENSDARG00000045316
- ZFIN ID:
- ZDB-GENE-091118-82
- Human Orthologue:
- MAP7D2
- Human Description:
- MAP7 domain containing 2 [Source:HGNC Symbol;Acc:25899]
- Mouse Orthologue:
- Mtap7d2
- Mouse Description:
- MAP7 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917474]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa8568 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8568
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080602 | Essential Splice Site | 87 | 649 | 3 | 18 |
ENSDART00000140170 | Essential Splice Site | 19 | 552 | 3 | 16 |
The following transcripts of ENSDARG00000045316 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 24 (position 24763515)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 24010393 GRCz11 24 24155567 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCCGCTCTGCYGTCGAGGAGAAGAGACRCCARCGCGTGGAAGACRAGAAG[G/A]TCAGAGCTYTTGGACTAACTTTGTATCATTCTGAAGCTTTTTTATGTATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: