zgc:92111

Ensembl ID:
ENSDARG00000045306
ZFIN ID:
ZDB-GENE-040912-10
Description:
Organic solute transporter subunit alpha [Source:UniProtKB/Swiss-Prot;Acc:Q66I08]
Human Orthologue:
AC069257.9
Human Description:
Organic solute transporter subunit alpha [Source:UniProtKB/Swiss-Prot;Acc:Q86UW1]
Mouse Orthologue:
Osta
Mouse Description:
organic solute transporter alpha Gene [Source:MGI Symbol;Acc:MGI:2146634]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37896 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066631 Nonsense 160 326 5 8

The following transcripts of ENSDARG00000045306 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 25584284)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24831162
GRCz11 24 24976336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGAAAAAAACTGATGTGTGTTGATTTTCAGACGATCTCTGTTCATAT[T/A]GAAACTGGGCTCCTACCAGTTTGCACTGATGAAATTGGTCCTCACCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link