zgc:110259

Ensembl ID:
ENSDARG00000045294
ZFIN ID:
ZDB-GENE-050417-89
Description:
SH3-domain GRB2-like endophilin B1 [Source:RefSeq peptide;Acc:NP_001017617]
Human Orthologue:
SH3GLB1
Human Description:
SH3-domain GRB2-like endophilin B1 [Source:HGNC Symbol;Acc:10833]
Mouse Orthologue:
Sh3glb1
Mouse Description:
SH3-domain GRB2-like B1 (endophilin) Gene [Source:MGI Symbol;Acc:MGI:1859730]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30115 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018095 Nonsense 158 360 5 9
Genomic Location (Zv9):
Chromosome 24 (position 29309401)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28307717
GRCz11 24 28386876
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGAAATTCGAGTTTAACAAACTAATTGCATCTACTTCTTTACAGAAA[G/T]AGCGCAAACTGCTTCAGAACAAACGATTGGACCTTGATGCGGCAAAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link