zgc:110030

Ensembl ID:
ENSDARG00000045249
ZFIN ID:
ZDB-GENE-050706-80
Description:
NIF3-like protein 1 [Source:RefSeq peptide;Acc:NP_001025139]
Human Orthologue:
NIF3L1
Human Description:
NIF3 NGG1 interacting factor 3-like 1 (S. pombe) [Source:HGNC Symbol;Acc:13390]
Mouse Orthologue:
Nif3l1
Mouse Description:
Ngg1 interacting factor 3-like 1 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1929485]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13824 Nonsense Available for shipment Available now
sa35188 Nonsense Available for shipment Available now
sa15947 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066546 Nonsense 153 347 3 7
ENSDART00000130693 Nonsense 242 425 2 7
Genomic Location (Zv9):
Chromosome 12 (position 4558507)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3841229
GRCz11 12 3877994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGGATTGARTTCTCATGCAYGGAYGAYGGAGAASTAARCAGCCTTT[T/A]GGAGCAGCTGAGACACACAGAGGGCAGCGAAACCTTTCAGTGCACTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066546 Nonsense 155 347 3 7
ENSDART00000130693 Nonsense 244 425 2 7
Genomic Location (Zv9):
Chromosome 12 (position 4558512)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3841234
GRCz11 12 3877999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTGAGTTCTCATGCATGGATGATGGAGAAGTAAACAGCCTTTTGGAG[C/T]AGCTGAGACACACAGAGGGCAGCGAAACCTTTCAGTGCACTAGAATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066546 Nonsense 284 347 6 7
ENSDART00000130693 Nonsense 373 425 5 7
Genomic Location (Zv9):
Chromosome 12 (position 4565871)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3848593
GRCz11 12 3885358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCYGGTTCTGGAGCTTCTGTCATACAAGGAGYAACAGCAGACCTCTA[C/A]ATCACTGGTACGTCACAGACATCAAAAAAGSAATTTAYTATCAATTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link