h3f3b.1

Ensembl ID:
ENSDARG00000045248
ZFIN IDs:
ZDB-GENE-030131-8175, ZDB-GENE-030131-8175, ZDB-GENE-040426-1023, ZDB-GENE-050417-65, ZDB-GENE-050417-65
Description:
Histone H3.3 [Source:UniProtKB/Swiss-Prot;Acc:Q6PI20]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45837 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24547 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066545 Essential Splice Site 43 136 2 3
ENSDART00000137017 Essential Splice Site 43 136 3 4
Genomic Location (Zv9):
Chromosome 24 (position 39195253)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37804342
GRCz11 24 37692239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGATTTATTTTTTAATGCACAAATTAATTTTTTTTCTTTCTCTCCTA[G/A]TCCTGGAACTGTGGCTCTTCGTGAGATCCGTCGGTACCAGAAGTCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066545 Nonsense 130 136 3 3
ENSDART00000137017 Nonsense 130 136 4 4
Genomic Location (Zv9):
Chromosome 24 (position 39195613)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37804702
GRCz11 24 37692599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACGCCAAACGTGTCACCATCATGCCCAAAGACATCCAGTTGGCCCGT[C/T]GAATCCGTGGAGAACGTGCTTAAACTCTCTACTATTTACTCTTTTTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link