smyhc3

Ensembl ID:
ENSDARG00000045242
ZFIN ID:
ZDB-GENE-080930-1
Description:
slow myosin heavy chain 3 [Source:RefSeq peptide;Acc:NP_001129995]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30158 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066527 Nonsense 1133 1938 24 37
Genomic Location (Zv9):
Chromosome 24 (position 42301720)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTGAAGAGCTTGAGGAAGAGCTGGAGGCTGAGAGAGCTGCTCGTGCC[A/T]AGGTTGAGAAACAGAGAGCCGATCTGTCCAGAGAACTGGAGGAGATCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link