zgc:55262

Ensembl ID:
ENSDARG00000045199
ZFIN ID:
ZDB-GENE-040426-2814
Description:
calpain 1, large subunit [Source:RefSeq peptide;Acc:NP_998624]
Human Orthologue:
CAPN1
Human Description:
calpain 1, (mu/I) large subunit [Source:HGNC Symbol;Acc:1476]
Mouse Orthologue:
Capn1
Mouse Description:
calpain 1 Gene [Source:MGI Symbol;Acc:MGI:88263]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20857 Essential Splice Site Available for shipment Available now
sa34003 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002949 Essential Splice Site 85 703 3 21
ENSDART00000077071 Essential Splice Site 85 701 3 23
ENSDART00000113658 Essential Splice Site 85 704 3 22
Genomic Location (Zv9):
Chromosome 7 (position 7536557)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 6595895
GRCz11 7 6731593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAATTGCTCAGGTATAGATGTAATGTAGCTGTGTTTGTGTTTCTTCA[G/A]GAAATGTGTGCGCGTCCTCAGTTTATCGTGGATGGAGCCACTCGCACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002949 Nonsense 423 703 11 21
ENSDART00000077071 Nonsense 421 701 13 23
ENSDART00000113658 Nonsense 423 704 11 22
Genomic Location (Zv9):
Chromosome 7 (position 7507934)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 6567272
GRCz11 7 6702970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGCAGCTTCCTGGTGGCGCTGATGCAGAAGGACCGCAGGAAGAAGAGA[A/T]GAGAAGGGCAGGACATGGAGACTATCGGATTCGCCATTTATGAGGTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link