zgc:73189

Ensembl ID:
ENSDARG00000045156
ZFIN ID:
ZDB-GENE-040426-1708
Description:
regulator of G-protein signaling 9 [Source:RefSeq peptide;Acc:NP_957124]
Human Orthologue:
RGS9
Human Description:
regulator of G-protein signaling 9 [Source:HGNC Symbol;Acc:10004]
Mouse Orthologue:
Rgs9
Mouse Description:
regulator of G-protein signaling 9 Gene [Source:MGI Symbol;Acc:MGI:1338824]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17031 Nonsense Available for shipment Available now
sa2644 Essential Splice Site F2 line generated During 2018
sa17918 Essential Splice Site Available for shipment Available now
sa18091 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034161 Nonsense 116 661 5 19
ENSDART00000127981 Nonsense 116 481 5 17
ENSDART00000143979 Nonsense 116 661 5 19
Genomic Location (Zv9):
Chromosome 12 (position 19718623)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18570784
GRCz11 12 18692658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTTCCATACATTTCTTCCTCCAGACACCATATTTTTGGCCTGCACAG[C/T]AATGGCCGGTGGAAGAYACAGACTATGGTGTGTAATCATGRTTCAKTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2644
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034161 Essential Splice Site 249 661 11 19
ENSDART00000127981 Essential Splice Site 249 481 11 17
ENSDART00000143979 Essential Splice Site 249 661 11 19
Genomic Location (Zv9):
Chromosome 12 (position 19725878)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18578039
GRCz11 12 18699913
KASP Assay ID:
554-2926.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTGCATCATGAGACCAAGGGTAAAGTCATCTGTGTCAATTGGAGC[G/A]TAAGTTACTGTTAAACTATAACTGCATTCATAAATTATTATAAAGCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034161 Essential Splice Site 249 661 11 19
ENSDART00000127981 Essential Splice Site 249 481 11 17
ENSDART00000143979 Essential Splice Site 249 661 11 19
Genomic Location (Zv9):
Chromosome 12 (position 19725879)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18578040
GRCz11 12 18699914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGTGCATCATGAGACCAAGGGTAAAGTCMTCTGTGWCAATTGGAGCR[T/A]AAGTTACTGTTAAACTATAACTGCATTCATAAATTATTATAAAGCTACAANNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034161 Nonsense 386 661 15 19
ENSDART00000127981 Nonsense 386 481 15 17
ENSDART00000143979 Nonsense 386 661 15 19
Genomic Location (Zv9):
Chromosome 12 (position 19728740)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18580901
GRCz11 12 18702775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAAAACAATGGAAATAAYAGTGAAGGGTTTGGGACACCCTCATCGTTA[T/A]GTACTGGATGCTGCCCAGACTCACATTTACATGCTCATGAAAAAGGTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link