vdac1

Ensembl ID:
ENSDARG00000045132
ZFIN ID:
ZDB-GENE-030131-6514
Description:
voltage-dependent anion-selective channel protein 1 [Source:RefSeq peptide;Acc:NP_001001404]
Human Orthologue:
VDAC1
Human Description:
voltage-dependent anion channel 1 [Source:HGNC Symbol;Acc:12669]
Mouse Orthologue:
Vdac1
Mouse Description:
voltage-dependent anion channel 1 Gene [Source:MGI Symbol;Acc:MGI:106919]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5963 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa5963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066373 Essential Splice Site 254 283 8 9
Genomic Location (Zv9):
Chromosome 21 (position 43898838)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45150998
GRCz11 21 45191843
KASP Assay ID:
554-3808.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAACTCGAGCCTTGTCGGGCTGGGATACACTCAAACTCTGAAGCCTGG[T/C]AAGTGTGTGTAGATATTATTAAACAGGGCTCTGCTGAAAAATCCAGCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link