si:dkey-222b8.1

Ensembl ID:
ENSDARG00000045094
ZFIN ID:
ZDB-GENE-060503-248
Description:
hypothetical protein LOC560317 [Source:RefSeq peptide;Acc:NP_001038388]
Human Orthologue:
SMAD4
Human Description:
SMAD family member 4 [Source:HGNC Symbol;Acc:6770]
Mouse Orthologue:
Smad4
Mouse Description:
MAD homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:894293]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13043 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047862 Essential Splice Site 264 547 None 14
ENSDART00000139040 Essential Splice Site 288 571 None 11
Genomic Location (Zv9):
Chromosome 19 (position 24442520)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24372632
GRCz11 19 23956855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGCTACAATAGCTCCAAACACTCCCAGACGCAAGGCTCCTTTCACAG[T/C]CAGTATTACGCATAGAATAAAGCAMCCACCCTAATTAACTGATACCCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link