Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cdkrap3
- Ensembl ID:
- ENSDARG00000045092
- ZFIN ID:
- ZDB-GENE-040625-90
- Description:
- CDK5 regulatory subunit-associated protein 3 [Source:RefSeq peptide;Acc:NP_001002105]
- Human Orthologue:
- CDK5RAP3
- Human Description:
- CDK5 regulatory subunit associated protein 3 [Source:HGNC Symbol;Acc:18673]
- Mouse Orthologue:
- Cdk5rap3
- Mouse Description:
- CDK5 regulatory subunit associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:1933126]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa7362 | Missense | Mutation detected in F1 DNA | During 2018 |
| sa22121 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa7362
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Missense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000066304 | Missense | 146 | 507 | 6 | 14 |
| ENSDART00000133703 | Missense | 146 | 509 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 12 (position 30375681)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 28712618 GRCz11 12 28827520 - KASP Assay ID:
- 554-4222.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAGGAAGCAGGTGTCTAAAGCTCAACAGCTGCAGCAGGAGCTGAGCCGA[C/T]GTGAGCTGGAGTGTCAGAGCGGTTCTGCCGACWTGAGAGAACGCTATTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22121
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000066304 | Nonsense | 180 | 507 | 7 | 14 |
| ENSDART00000133703 | Nonsense | 180 | 509 | 7 | 14 |
- Genomic Location (Zv9):
- Chromosome 12 (position 30375857)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 28712794 GRCz11 12 28827696 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAACAAATAACATTTGTGTTTCACAGGGGGAAAACGTGGCAAGGGAGTTG[C/T]AAGCACAGGTTAAAGATCTGCCTGTGGTTTTAGAAGAAACTGGAAAAAAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
