
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mrpl10
- Ensembl ID:
- ENSDARG00000045091
- ZFIN ID:
- ZDB-GENE-050320-19
- Description:
- 39S ribosomal protein L10, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q5BJB7]
- Human Orthologue:
- MRPL10
- Human Description:
- mitochondrial ribosomal protein L10 [Source:HGNC Symbol;Acc:14055]
- Mouse Orthologue:
- Mrpl10
- Mouse Description:
- mitochondrial ribosomal protein L10 Gene [Source:MGI Symbol;Acc:MGI:1333801]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12492 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12492
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066303 | Nonsense | 150 | 252 | 4 | 5 |
The following transcripts of ENSDARG00000045091 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 30345245)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 28682182 GRCz11 12 28797084 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGCATTTACGGTAACATGTCACCTCTAATTTTTGGCGAGACTGTCCTGT[T/A]AGCTAGTAAAGAGCCAAAAGTTAAAGAGATGCTGCAGGCATTGAGGCACA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Alzheimer's disease (cognitive decline): Genome-wide association study of the rate of cognitive decline in Alzheimer's disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: