zgc:85939

Ensembl ID:
ENSDARG00000045019
ZFIN IDs:
ZDB-GENE-040426-2370, ZDB-GENE-040426-2370
Description:
angio-associated migratory cell protein [Source:RefSeq peptide;Acc:NP_998103]
Human Orthologue:
AAMP
Human Description:
angio-associated, migratory cell protein [Source:HGNC Symbol;Acc:18]
Mouse Orthologue:
Aamp
Mouse Description:
angio-associated migratory protein Gene [Source:MGI Symbol;Acc:MGI:107809]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33989 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082325 Nonsense 295 416 8 12
ENSDART00000102127   None 292 None 9
Genomic Location (Zv9):
Chromosome 6 (position 59644701)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59986289
GRCz11 6 59918502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCAGGTGTTGTGCTCGTTCTCCAGTCAGACCAGTGAAGGCAGCGGCT[C/A]GGCGCAGGACTCCAACTCTGTAGAGTCTGTGGGCTTCTGTAATGTGTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link