
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-51f10.1
- Ensembl ID:
- ENSDARG00000045011
- ZFIN ID:
- ZDB-GENE-060503-136
- Description:
- hypothetical protein LOC100034470 [Source:RefSeq peptide;Acc:NP_001124083]
- Human Orthologue:
- TAPBP
- Human Description:
- TAP binding protein (tapasin) [Source:HGNC Symbol;Acc:11566]
- Mouse Orthologue:
- Tapbp
- Mouse Description:
- TAP binding protein Gene [Source:MGI Symbol;Acc:MGI:1201689]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23435 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23435
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053438 | Nonsense | 141 | 244 | 4 | 6 |
ENSDART00000104848 | Nonsense | 221 | 465 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 19 (position 7691543)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 7150082 GRCz11 19 7069007 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGTTCGCTGTAGACTGGGAGAGCCGGTTCTGCTGGATTGTGGCTTCTG[G/A]ATTGATCCGTCTTCTCCTCTTCACGGCTCTGGATTCTCCATCGAGTGGCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: