vsg1

Ensembl ID:
ENSDARG00000045003
ZFIN ID:
ZDB-GENE-060616-96
Description:
vessel-specific 1 [Source:RefSeq peptide;Acc:NP_001025415]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13080 Nonsense Available for shipment Available now
sa18400 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066164 Nonsense 212 409 3 5

The following transcripts of ENSDARG00000045003 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 6081509)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6049692
GRCz11 11 6046947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCACGCAGTGAAGGATAAAAACGAGCACCACAGCCAGGTGATAAAACTG[A/T]GACAGGAAAACAAAGATTTGAAATCTCAGCTTGATGTTTACACCAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066164 Nonsense 396 409 4 5

The following transcripts of ENSDARG00000045003 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 6080868)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6049051
GRCz11 11 6046306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGTTTAACTGTATGYTAAAWGTTGTGCAGGCCAAAYCGTCTGGTTTT[C/T]AGCCTCTGGGATCAGYTGGCCAGTATCCCTCCACATCAGGTTGAGGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link