zgc:65811

Ensembl ID:
ENSDARG00000044990
ZFIN ID:
ZDB-GENE-040426-1428
Description:
hypothetical protein LOC393524 [Source:RefSeq peptide;Acc:NP_956846]
Human Orthologues:
CD81, CD9, TSPAN2
Human Descriptions:
CD81 molecule [Source:HGNC Symbol;Acc:1701]
CD9 molecule [Source:HGNC Symbol;Acc:1709]
tetraspanin 2 [Source:HGNC Symbol;Acc:20659]
Mouse Orthologues:
Cd81, Cd9, Tspan2
Mouse Descriptions:
CD81 antigen Gene [Source:MGI Symbol;Acc:MGI:1096398]
CD9 antigen Gene [Source:MGI Symbol;Acc:MGI:88348]
tetraspanin 2 Gene [Source:MGI Symbol;Acc:MGI:1917997]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33074 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066142 Essential Splice Site 21 176 2 7
Genomic Location (Zv9):
Chromosome 3 (position 2123790)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149855.1 18795
GRCz11 KN149855.1 18795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGATTGGTTGATTATTGATTGATTGATTGATTGATTGATTGTCTCC[A/C]GCTGCTGGGCTTCAGTCTGGTGTCTCTGGGATTGTGGCTCCGCTTCGGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link