zgc:136902

Ensembl ID:
ENSDARG00000044976
ZFIN ID:
ZDB-GENE-060421-4592
Description:
hypothetical protein LOC678611 [Source:RefSeq peptide;Acc:NP_001035449]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41792 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35038 Nonsense Mutation detected in F1 DNA During 2018
sa21860 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005485 Essential Splice Site 188 462 3 8
Genomic Location (Zv9):
Chromosome 11 (position 11577587)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11472590
GRCz11 11 11456211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTGTCATGTTTACTAATTTATTTCCTATGTGACCTCTCCACCAATCA[G/A]ATTCGAGCATGAGGTTGTGATGCGCCAGTGTGTAGAATCTGACATCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005485 Nonsense 290 462 4 8
Genomic Location (Zv9):
Chromosome 11 (position 11577096)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11472099
GRCz11 11 11455720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCATTACGAGAACATTATTCAGAAACACCGCAGGGAACAGGAAGCCT[G/A]GTTTAAAGACAAGGTAAGACTTCTGATTGCTCTCTTGAATCCCATGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005485 Nonsense 361 462 6 8
Genomic Location (Zv9):
Chromosome 11 (position 11576592)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11471595
GRCz11 11 11455216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCAGAAACAGAAGCTAGGTACAGTGCTATGCTAGCAGGCTTCCAAAAT[C/T]AAATCAACAACCTGGAAGCTGAGTTGGCTCAGTTGAGAGCTAGCATTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link