zgc:153629

Ensembl ID:
ENSDARG00000044975
ZFIN ID:
ZDB-GENE-061027-116
Description:
hypothetical protein LOC768289 [Source:RefSeq peptide;Acc:NP_001070922]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21861 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030103 Nonsense 379 431 6 8
Genomic Location (Zv9):
Chromosome 11 (position 11590486)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11485489
GRCz11 11 11469110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGTTGGCTCAGTTGAGAGCTAGCATTGAGCAGCAGTCACGAGATTA[C/A]ATCTTGTTGCTGGACATCAAGACTCGTCTGGAGCAGGAGATCGCCACCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link