vcl

Ensembl ID:
ENSDARG00000044968
ZFIN ID:
ZDB-GENE-050506-61
Description:
vinculin [Source:RefSeq peptide;Acc:NP_001122153]
Human Orthologue:
VCL
Human Description:
vinculin [Source:HGNC Symbol;Acc:12665]
Mouse Orthologues:
Gm14025, Vcl
Mouse Descriptions:
predicted gene 14025 Gene [Source:MGI Symbol;Acc:MGI:3649276]
vinculin Gene [Source:MGI Symbol;Acc:MGI:98927]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10865 Nonsense Available for shipment Available now
sa35485 Nonsense Mutation detected in F1 DNA During 2018
sa14599 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039828 Nonsense 232 1131 6 22
ENSDART00000110304 Nonsense 232 1130 6 23
ENSDART00000124167 Nonsense 232 1131 6 22

The following transcripts of ENSDARG00000044968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 25475255)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25120915
GRCz11 13 25251365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGCACTAAGAGTCAYGGTGTGGAGGAGGCCTTGAAGAACAGAAACTA[C/A]ACGTTTGATAAGATGACAGCTGAAATCAACGAGATAAKCAGAGTGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039828 Nonsense 284 1131 7 22
ENSDART00000110304 Nonsense 283 1130 7 23
ENSDART00000124167 Nonsense 283 1131 7 22

The following transcripts of ENSDARG00000044968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 25466474)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25112134
GRCz11 13 25242584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAGCGCTGGCGCTGATCGAGTCTAAGATGGGTCAGGCTAAAGGCTG[G/A]CTGAGGGACCCCAATGCACTGCCAGGTATTCACCTTGTTTATCACGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039828 Nonsense 546 1131 12 22
ENSDART00000110304 Nonsense 545 1130 12 23
ENSDART00000124167 Nonsense 545 1131 12 22

The following transcripts of ENSDARG00000044968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 25451101)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25096761
GRCz11 13 25227211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGCGAGYTCTCTGCCAGGGCCGTACAGACAGGAGCTGCTGGCCAAATG[T/A]GAGCAGGTGGAGCAGCTGATGATGCAGCTGGCGGATCTGGCAGCRCGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link