slit1a

Ensembl ID:
ENSDARG00000044954
ZFIN ID:
ZDB-GENE-030722-3
Description:
slit homolog 1 protein [Source:RefSeq peptide;Acc:NP_001030140]
Human Orthologue:
SLIT1
Human Description:
slit homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:11085]
Mouse Orthologue:
Slit1
Mouse Description:
slit homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1315203]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11050 Nonsense Available for shipment Available now
sa12013 Nonsense Available for shipment Available now
sa1497 Essential Splice Site Available for shipment Available now
sa16176 Essential Splice Site Available for shipment Available now
sa22189 Essential Splice Site Available for shipment Available now
sa35388 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066080 Nonsense 8 1524 1 38
ENSDART00000128969 Nonsense 8 1524 1 37
Genomic Location (Zv9):
Chromosome 13 (position 510049)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 508032
GRCz11 13 638323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTNCTCGGGGAGTCTTAGGAAGATCATGCCTGCGAGAGGAGGATGTTG[T/A]CTGCTGGAGGTGTGTGTGTKGGTTTTGCTGCTGGTGTGTAAGACTGRCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066080 Nonsense 717 1524 21 38
ENSDART00000128969 Nonsense 717 1524 21 37
Genomic Location (Zv9):
Chromosome 13 (position 446882)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 444865
GRCz11 13 575156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATACTGATGTTGATGTTGGTGTGGTGGTGTTTTCTGTCTCAGATCAT[G/T]AGGACRTGAGCTGTGCGCCGCCGGTCCACTGTCCTGCTGACTGCAYCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066080 Essential Splice Site 854 1524 25 38
ENSDART00000128969 Essential Splice Site 854 1524 25 37
Genomic Location (Zv9):
Chromosome 13 (position 441559)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 439542
GRCz11 13 569833
KASP Assay ID:
554-1422.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGAGCTGCCGGACGGGATCTTCTCTGACGCTCAGTCACTGTCACATCT[G/A]TGAGTACAGCGAACACATCTTTCTGTGTTTGCATAGGAATAAGATTTATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066080 Essential Splice Site 1107 1524 31 38
ENSDART00000128969 Essential Splice Site 1107 1524 31 37
Genomic Location (Zv9):
Chromosome 13 (position 435402)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 433385
GRCz11 13 563676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGGACGAGCTTAACGGATACTCCTGYRTCTGCCAGAAGGGATACAGG[T/G]CTGTTCTGCACARCAAATTAATATCAAACAACACAGAATATAATACAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066080 Essential Splice Site 1227 1524 34 38
ENSDART00000128969 Essential Splice Site 1227 1524 34 37
Genomic Location (Zv9):
Chromosome 13 (position 433453)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 431436
GRCz11 13 561727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCTCCGTATATATAATCTGACGGTCCTCTGCTGTGTGTTTTGTGCGC[A/T]GCACTGAGACGGTCAATGATGGTCAGTTCCACACCGTAGAGCTGGTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066080 Essential Splice Site 1279 1524 34 38
ENSDART00000128969 Essential Splice Site 1279 1524 34 37
Genomic Location (Zv9):
Chromosome 13 (position 433295)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 431278
GRCz11 13 561569
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGGGAAGGTGCAGCCGCTGAGGGGAGAAGCTCCGCTGTATGTAGGAGG[T/G]AAGAGGGAACAACACATCTCTGCATCTGTTTATATACAACACATACTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link