zgc:162738

Ensembl ID:
ENSDARG00000044925
ZFIN ID:
ZDB-GENE-070424-90
Description:
CDK5 regulatory subunit-associated protein 1 [Source:RefSeq peptide;Acc:NP_001103849]
Human Orthologue:
CDK5RAP1
Human Description:
CDK5 regulatory subunit associated protein 1 [Source:HGNC Symbol;Acc:15880]
Mouse Orthologue:
Cdk5rap1
Mouse Description:
CDK5 regulatory subunit associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1914221]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9397 Nonsense Mutation detected in F1 DNA During 2018
sa35053 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104111 Nonsense 76 577 1 13
Genomic Location (Zv9):
Chromosome 11 (position 15843105)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15346320
GRCz11 11 15480955
KASP Assay ID:
2260-4083.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTCATCATGAGTTCTGATAAAAGCGATTTTGACGGCAGTGAGGAATA[T/A]GAGGAGCACTATATTCCTAAAWACATGTCAGACCATTCACGGAAAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104111 Essential Splice Site 505 577 11 13
Genomic Location (Zv9):
Chromosome 11 (position 15929987)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15433202
GRCz11 11 15567837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCAACATGACTCTTATCGGCAACACACAGCTTGTATTGGTAGAGGGAG[T/C]GAGTATAGCATCATACTTAATGAAGTTTTGCATATTTTTCGTCATTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link