zgc:113456

Ensembl ID:
ENSDARG00000044895
ZFIN ID:
ZDB-GENE-041008-23
Description:
fibromodulin-like [Source:RefSeq peptide;Acc:NP_001025243]
Human Orthologue:
FMOD
Human Description:
fibromodulin [Source:HGNC Symbol;Acc:3774]
Mouse Orthologue:
Fmod
Mouse Description:
fibromodulin Gene [Source:MGI Symbol;Acc:MGI:1328364]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17551 Nonsense Available for shipment Available now
sa9973 Essential Splice Site Available for shipment Available now
sa10007 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065985 Nonsense 32 342 2 3
Genomic Location (Zv9):
Chromosome 11 (position 21863167)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 20869398
GRCz11 11 21029966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGCKCAGGATCCATTCCAGTGGCTTTCTTCTTTACACAGCCGGGGTTA[T/A]GCTTCTTTACAAGCCGACAACACTGGTGGAGAGTGTCCCGAAGAGTGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9973
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065985 Essential Splice Site 292 342 2 3
Genomic Location (Zv9):
Chromosome 11 (position 21862385)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 20868616
GRCz11 11 21029184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTAGTACCAGTCTGCAACAKCTCTACCTACARGCCAATCAGATCAAAG[G/A]TACAGAACCTCTATGACCGTTCTGTAACTTTGCTCATWATTTAAGTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065985 Nonsense 314 342 3 3
Genomic Location (Zv9):
Chromosome 11 (position 21859980)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 20866211
GRCz11 11 21026779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTTYTGCAGTGTGGTGGATGTGATGAACTTYTCCAGGCTGAGAGTCT[T/A]GAGGCTGGAGGGAAATGAGATCGGCGCTGGAGACRTGCCTTCTGAAGCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link