zgc:113307

Ensembl ID:
ENSDARG00000044894
ZFIN ID:
ZDB-GENE-050522-29
Description:
hypothetical protein LOC553753 [Source:RefSeq peptide;Acc:NP_001018560]
Human Orthologues:
FMOD, LUM
Human Descriptions:
fibromodulin [Source:HGNC Symbol;Acc:3774]
lumican [Source:HGNC Symbol;Acc:6724]
Mouse Orthologues:
Fmod, Lum
Mouse Descriptions:
fibromodulin Gene [Source:MGI Symbol;Acc:MGI:1328364]
lumican Gene [Source:MGI Symbol;Acc:MGI:109347]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2608 Nonsense F2 line generated During 2018
sa5594 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa2608
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065984 Nonsense 60 343 2 4
ENSDART00000065984 Nonsense 60 343 2 4
Genomic Location (Zv9):
Chromosome 11 (position 21886869)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 20893100
GRCz11 11 21053668
KASP Assay ID:
554-3141.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGTGCGACTGCCCAATTCAGTGGCCRACAGCCATTTATTGTGACCAC[A/T]GAGGCCTTAACCAGCTTCCCTCTGGCCTTCCCTTCCGCCTGCAGTACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5594
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065984 Nonsense 60 343 2 4
ENSDART00000065984 Nonsense 60 343 2 4
Genomic Location (Zv9):
Chromosome 11 (position 21886869)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 20893100
GRCz11 11 21053668
KASP Assay ID:
554-3141.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGTGCGACTGCCCAATTCAGTGGCCRACAGCCATTTATTGTGACCAC[A/T]GAGGCCTTAACCAGCTTCCCTCTGGCCTTCCCTTCCGCCTGCAGTACCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link