zgc:92107

Ensembl ID:
ENSDARG00000044874
ZFIN ID:
ZDB-GENE-041114-4
Description:
hypothetical protein LOC492329 [Source:RefSeq peptide;Acc:NP_001007296]
Human Orthologue:
ARHGAP39
Human Description:
Rho GTPase activating protein 39 [Source:HGNC Symbol;Acc:29351]
Mouse Orthologue:
Arhgap39
Mouse Description:
Rho GTPase activating protein 39 Gene [Source:MGI Symbol;Acc:MGI:107858]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10787 Essential Splice Site Available for shipment Available now
sa18288 Nonsense Available for shipment Available now
sa35086 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065955 Essential Splice Site 585 1067 3 10
ENSDART00000129211 Essential Splice Site 585 1067 3 10

The following transcripts of ENSDARG00000044874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 25960213)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24789038
GRCz11 11 25026654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGAGAGTTATTTGTCTTTGCCDGAGACTTCTGGACCCCCCTCACAGG[T/C]ACTGCATAGATTMWCTGTTTGAYTCCTTATAAYCAGGTTGAATAATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065955 Nonsense 655 1067 4 10
ENSDART00000129211 Nonsense 655 1067 4 10

The following transcripts of ENSDARG00000044874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 25964851)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24793676
GRCz11 11 25031292
KASP Assay ID:
2260-4296.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCCTCCACCCCCAGACACCAGCATGACMGACKGGGCCAGCAAACACT[T/A]GAACAYGCACACCCAGGGCCTTTTCCGGCGCAAAGTCTCTATTGCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065955 Nonsense 896 1067 7 10
ENSDART00000129211 Nonsense 896 1067 7 10

The following transcripts of ENSDARG00000044874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 25970565)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24799390
GRCz11 11 25037006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGAGCGGCAGAGCGAGCTCTTTCCAGACAGGAAGCTGCCGTGGGTG[C/T]AGGTGCAGCTCTCGCAGTATGTGCTGGCTCTGGGTGGAGCTCAGACTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link