zgc:110084

Ensembl ID:
ENSDARG00000044853
ZFIN ID:
ZDB-GENE-050417-38
Description:
ribosomal RNA-processing protein 7 homolog A [Source:RefSeq peptide;Acc:NP_001017579]
Human Orthologue:
RRP7A
Human Description:
ribosomal RNA processing 7 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:24286]
Mouse Orthologues:
Gm3436, Rrp7a
Mouse Descriptions:
predicted pseudogene 3436 Pseudogene [Source:MGI Symbol;Acc:MGI:3781613]
ribosomal RNA processing 7 homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1922028]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11429 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065923 Essential Splice Site 18 280 1 7
Genomic Location (Zv9):
Chromosome 3 (position 1992567)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1450803
GRCz11 3 1219452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCCGTCCGCGAATAAAGACGCGTGCGTTATTCCAGGAGGATTTACAGG[T/C]AAAACTACTGTTATTAATGAGGTATTATAGTAAAATAATGAGCTGTTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link