zgc:171599

Ensembl ID:
ENSDARG00000044847
ZFIN ID:
ZDB-GENE-080219-33
Description:
Zgc:171599 protein [Source:UniProtKB/TrEMBL;Acc:A8KB69]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36531 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065917 Nonsense 81 191 2 3
ENSDART00000106537 Nonsense 81 334 2 2
Genomic Location (Zv9):
Chromosome 17 (position 50147257)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49533182
GRCz11 17 49633087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAGATGATGAACGAAGTGATTTAAAGAAAAGAAGACGGAAGAAATGTT[T/A]GACCTGCAGTCAGTGTGGGAAGAGTTTTGATTGCAAAAGCTATTTTAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link