zgc:66483

Ensembl ID:
ENSDARG00000044844
ZFIN ID:
ZDB-GENE-030131-5765
Description:
hypothetical protein LOC327554 [Source:RefSeq peptide;Acc:NP_956119]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19251 Nonsense Mutation detected in F1 DNA During 2018
sa9845 Nonsense Available for shipment Available now
sa37204 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065914 Nonsense 16 231 1 2
ENSDART00000141975 Nonsense 16 231 2 3
ENSDART00000065914 Nonsense 16 231 1 2
ENSDART00000141975 Nonsense 16 231 2 3
Genomic Location (Zv9):
Chromosome 21 (position 2580162)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2292573
GRCz11 21 2318397
KASP Assay ID:
2261-5099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGATGGAGATTGAGGAAGAACCCTGCAGAATAAAAGAGACAAAGAAA[C/T]AAACAGGTTTGTGTTTACATTCTTCCTCTTTAGCCCTTGTGTATTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065914 Nonsense 16 231 1 2
ENSDART00000141975 Nonsense 16 231 2 3
ENSDART00000065914 Nonsense 16 231 1 2
ENSDART00000141975 Nonsense 16 231 2 3
Genomic Location (Zv9):
Chromosome 21 (position 2580162)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2292573
GRCz11 21 2318397
KASP Assay ID:
2261-5099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRAAGATGGAGATTGAGGAAGAACCCTGCAGAATAAAAGAGACAAAGAAA[C/T]AAACAGGTTTGYGTTTACATTCTTCCTCTTYARCCCKTGTGTATTRTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065914 Nonsense 157 231 2 2
ENSDART00000141975 Nonsense 157 231 3 3
Genomic Location (Zv9):
Chromosome 21 (position 2582166)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2290569
GRCz11 21 2316393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACACCTTTATGTCCATGCGACGGTGAAGCCACTCGCTTGCTCTTTCTG[C/A]GGAAAGACTTTTTTACATTTGCAGAAGTTGAAAGTGCATGAGCTTATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link